ID: 918099865_918099874

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 918099865 918099874
Species Human (GRCh38) Human (GRCh38)
Location 1:181364043-181364065 1:181364091-181364113
Sequence CCTGGAGGCAAGTCAGGCTAGGC AATGGCTGTTCCAGATTGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!