ID: 918338646_918338652

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 918338646 918338652
Species Human (GRCh38) Human (GRCh38)
Location 1:183548158-183548180 1:183548185-183548207
Sequence CCCTGGCACTTGAAGTTCCCTTA TTTGCCTGGGTAGTAGCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 200} {0: 1, 1: 0, 2: 5, 3: 27, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!