ID: 918374999_918375008

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 918374999 918375008
Species Human (GRCh38) Human (GRCh38)
Location 1:183900202-183900224 1:183900243-183900265
Sequence CCATGCTTGACACTGCCCTTCAG TCCATGTGGGTGGTGTGATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 274} {0: 1, 1: 0, 2: 1, 3: 29, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!