ID: 918515968_918515971

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 918515968 918515971
Species Human (GRCh38) Human (GRCh38)
Location 1:185363566-185363588 1:185363589-185363611
Sequence CCCAAAGGCTCCTAGAACTAATA AACAACTTCAGTAACATTTCAGG
Strand - +
Off-target summary {0: 9, 1: 116, 2: 525, 3: 1466, 4: 2082} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!