ID: 918515969_918515971

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 918515969 918515971
Species Human (GRCh38) Human (GRCh38)
Location 1:185363567-185363589 1:185363589-185363611
Sequence CCAAAGGCTCCTAGAACTAATAA AACAACTTCAGTAACATTTCAGG
Strand - +
Off-target summary {0: 3, 1: 37, 2: 99, 3: 296, 4: 708} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!