ID: 918611564_918611571

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 918611564 918611571
Species Human (GRCh38) Human (GRCh38)
Location 1:186498195-186498217 1:186498232-186498254
Sequence CCAACTACAGCGGTCATCCAGGA CTACCTGCTTTTTCAGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} {0: 1, 1: 0, 2: 0, 3: 24, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!