ID: 918718118_918718123

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 918718118 918718123
Species Human (GRCh38) Human (GRCh38)
Location 1:187817989-187818011 1:187818031-187818053
Sequence CCCAGCAGAGACTCTGCATGGGC CTTCCACACTACCCTAGCAGAGG
Strand - +
Off-target summary No data {0: 27, 1: 405, 2: 721, 3: 1455, 4: 1579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!