ID: 918829615_918829622

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 918829615 918829622
Species Human (GRCh38) Human (GRCh38)
Location 1:189376892-189376914 1:189376924-189376946
Sequence CCTCCCGCCTCGGCCTTCCAAAA TACACAACCTCACTTATTTCTGG
Strand - +
Off-target summary {0: 39, 1: 2382, 2: 50094, 3: 141201, 4: 206670} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!