ID: 918829616_918829622

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 918829616 918829622
Species Human (GRCh38) Human (GRCh38)
Location 1:189376895-189376917 1:189376924-189376946
Sequence CCCGCCTCGGCCTTCCAAAATGC TACACAACCTCACTTATTTCTGG
Strand - +
Off-target summary {0: 116, 1: 5945, 2: 105189, 3: 241515, 4: 243972} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!