ID: 918829618_918829622

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 918829618 918829622
Species Human (GRCh38) Human (GRCh38)
Location 1:189376899-189376921 1:189376924-189376946
Sequence CCTCGGCCTTCCAAAATGCTAGG TACACAACCTCACTTATTTCTGG
Strand - +
Off-target summary {0: 19, 1: 840, 2: 18083, 3: 164257, 4: 292044} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!