ID: 918829620_918829622

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 918829620 918829622
Species Human (GRCh38) Human (GRCh38)
Location 1:189376905-189376927 1:189376924-189376946
Sequence CCTTCCAAAATGCTAGGATTACA TACACAACCTCACTTATTTCTGG
Strand - +
Off-target summary {0: 68, 1: 2937, 2: 49957, 3: 346657, 4: 255670} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!