ID: 919204581_919204586

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 919204581 919204586
Species Human (GRCh38) Human (GRCh38)
Location 1:194405711-194405733 1:194405750-194405772
Sequence CCATAGAATACTATGCAGCCATA TGTTCTTTGCAGGACATGGATGG
Strand - +
Off-target summary No data {0: 2, 1: 13, 2: 34, 3: 70, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!