|
Left Crispr |
Right Crispr |
Crispr ID |
919204583 |
919204586 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:194405729-194405751
|
1:194405750-194405772
|
Sequence |
CCATAAAAAAGAATGAGGTCATG |
TGTTCTTTGCAGGACATGGATGG |
Strand |
- |
+ |
Off-target summary |
{0: 38, 1: 2273, 2: 11493, 3: 21571, 4: 12725} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|