ID: 919220864_919220870

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 919220864 919220870
Species Human (GRCh38) Human (GRCh38)
Location 1:194626608-194626630 1:194626639-194626661
Sequence CCCCAAGTAAAAGACACAGAATG GGTAAAGAGTCAAGACCTATTGG
Strand - +
Off-target summary {0: 3, 1: 217, 2: 1963, 3: 1759, 4: 1577} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!