ID: 919236734_919236741

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 919236734 919236741
Species Human (GRCh38) Human (GRCh38)
Location 1:194855275-194855297 1:194855319-194855341
Sequence CCTTGTCTTTACTAAAAATACAA CGGGCACCTACATTCCCCTGAGG
Strand - +
Off-target summary {0: 1957, 1: 69203, 2: 164157, 3: 184952, 4: 112746} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!