ID: 919256318_919256322

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 919256318 919256322
Species Human (GRCh38) Human (GRCh38)
Location 1:195129095-195129117 1:195129126-195129148
Sequence CCCTTTTAAACATAAGTTCCAAT TTCTCTGTGAATATATAAAACGG
Strand - +
Off-target summary {0: 272, 1: 405, 2: 533, 3: 528, 4: 851} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!