|
Left Crispr |
Right Crispr |
Crispr ID |
919256319 |
919256322 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:195129096-195129118
|
1:195129126-195129148
|
Sequence |
CCTTTTAAACATAAGTTCCAATT |
TTCTCTGTGAATATATAAAACGG |
Strand |
- |
+ |
Off-target summary |
{0: 279, 1: 446, 2: 580, 3: 547, 4: 776} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|