ID: 919256319_919256322

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 919256319 919256322
Species Human (GRCh38) Human (GRCh38)
Location 1:195129096-195129118 1:195129126-195129148
Sequence CCTTTTAAACATAAGTTCCAATT TTCTCTGTGAATATATAAAACGG
Strand - +
Off-target summary {0: 279, 1: 446, 2: 580, 3: 547, 4: 776} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!