ID: 919267156_919267158

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 919267156 919267158
Species Human (GRCh38) Human (GRCh38)
Location 1:195284340-195284362 1:195284392-195284414
Sequence CCCATTCTGTACATTGTCTGTTT GAAGCTGTTTAGTTTAGTTAAGG
Strand - +
Off-target summary {0: 10, 1: 182, 2: 1779, 3: 4241, 4: 14842} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!