ID: 919455761_919455770

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 919455761 919455770
Species Human (GRCh38) Human (GRCh38)
Location 1:197818221-197818243 1:197818271-197818293
Sequence CCTCCAGCAGTGGCTGCATGGCA ATGGAGAGCATAGTGATTGTGGG
Strand - +
Off-target summary {0: 3, 1: 7, 2: 36, 3: 80, 4: 394} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!