ID: 919666387_919666391

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 919666387 919666391
Species Human (GRCh38) Human (GRCh38)
Location 1:200296837-200296859 1:200296862-200296884
Sequence CCTTAAAAGGGTGAGCTCTGCCG CAAGGACCAAGAGATCAAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!