ID: 919941038_919941046

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 919941038 919941046
Species Human (GRCh38) Human (GRCh38)
Location 1:202286433-202286455 1:202286486-202286508
Sequence CCCAATCACTTGTTGAGAAAGAC GATGGGGAAACTGAGACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 144} {0: 1, 1: 8, 2: 77, 3: 565, 4: 2107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!