ID: 919958093_919958103

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 919958093 919958103
Species Human (GRCh38) Human (GRCh38)
Location 1:202438896-202438918 1:202438927-202438949
Sequence CCACCGCACGCGGCCCTGTGCCT CCCCGAAGACGGCCGTGGACTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 69, 4: 726} {0: 1, 1: 0, 2: 1, 3: 4, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!