ID: 920039331_920039346

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 920039331 920039346
Species Human (GRCh38) Human (GRCh38)
Location 1:203085507-203085529 1:203085547-203085569
Sequence CCCCCGCCCCGGTAGCGGAGGTC GGGAGCTGAGCAGGGCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} {0: 1, 1: 0, 2: 12, 3: 142, 4: 990}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!