ID: 920044942_920044946

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 920044942 920044946
Species Human (GRCh38) Human (GRCh38)
Location 1:203127089-203127111 1:203127111-203127133
Sequence CCTTATGGCTTAGCGCTGTGCTA ATGAAGAGGAAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 94} {0: 1, 1: 2, 2: 50, 3: 501, 4: 3121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!