ID: 920058351_920058356

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 920058351 920058356
Species Human (GRCh38) Human (GRCh38)
Location 1:203209971-203209993 1:203210013-203210035
Sequence CCTAAGGAGAATGAAAAGCCAAG GCCAAACCTGCAGTCATGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 399} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!