ID: 920114287_920114294

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 920114287 920114294
Species Human (GRCh38) Human (GRCh38)
Location 1:203609102-203609124 1:203609133-203609155
Sequence CCTCTCAAGTAGCATGCACCACC CTAATTTTGCATTTTTAGTAGGG
Strand - +
Off-target summary No data {0: 10, 1: 320, 2: 240, 3: 377, 4: 3355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!