ID: 920114289_920114296

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 920114289 920114296
Species Human (GRCh38) Human (GRCh38)
Location 1:203609120-203609142 1:203609138-203609160
Sequence CCACCACACCCGGCTAATTTTGC TTTGCATTTTTAGTAGGGACGGG
Strand - +
Off-target summary No data {0: 55, 1: 5891, 2: 174906, 3: 211493, 4: 123826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!