ID: 920114289_920114298

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 920114289 920114298
Species Human (GRCh38) Human (GRCh38)
Location 1:203609120-203609142 1:203609153-203609175
Sequence CCACCACACCCGGCTAATTTTGC GGGACGGGGTTTCTCCATGTTGG
Strand - +
Off-target summary {0: 43, 1: 2395, 2: 27169, 3: 122893, 4: 209105} {0: 83, 1: 7612, 2: 58807, 3: 145939, 4: 142222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!