ID: 920217152_920217155

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 920217152 920217155
Species Human (GRCh38) Human (GRCh38)
Location 1:204368976-204368998 1:204369020-204369042
Sequence CCTGGGTTCTGCAGAGTGGCAGG TTATTCACCTGTATTTATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 286} {0: 1, 1: 0, 2: 0, 3: 39, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!