ID: 920674607_920674611

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920674607 920674611
Species Human (GRCh38) Human (GRCh38)
Location 1:208030403-208030425 1:208030416-208030438
Sequence CCAGCGCTGGGCCGGGGATGCTC GGGGATGCTCCAAAGCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 181} {0: 1, 1: 0, 2: 0, 3: 25, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!