ID: 920728622_920728625

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 920728622 920728625
Species Human (GRCh38) Human (GRCh38)
Location 1:208461696-208461718 1:208461732-208461754
Sequence CCTGTTTGTTGGGGGGTCAAGTA TCAGATTCATACTTGGAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!