ID: 921032667_921032671

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 921032667 921032671
Species Human (GRCh38) Human (GRCh38)
Location 1:211347339-211347361 1:211347360-211347382
Sequence CCAGGCTTGAGGAAGCTTCAGAA AAGGAGACGGATCCTGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 222} {0: 1, 1: 0, 2: 2, 3: 19, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!