|
Left Crispr |
Right Crispr |
Crispr ID |
921106595 |
921106606 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:211987012-211987034
|
1:211987051-211987073
|
Sequence |
CCAGCCTGGGCACAGTGGCTCAT |
CTTTGAAAGGGCAAGGTGGGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 244, 2: 1348, 3: 3812, 4: 8056} |
{0: 2, 1: 90, 2: 2502, 3: 29774, 4: 86449} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|