ID: 921106595_921106606

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 921106595 921106606
Species Human (GRCh38) Human (GRCh38)
Location 1:211987012-211987034 1:211987051-211987073
Sequence CCAGCCTGGGCACAGTGGCTCAT CTTTGAAAGGGCAAGGTGGGTGG
Strand - +
Off-target summary {0: 8, 1: 244, 2: 1348, 3: 3812, 4: 8056} {0: 2, 1: 90, 2: 2502, 3: 29774, 4: 86449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!