|
Left Crispr |
Right Crispr |
| Crispr ID |
921106597 |
921106606 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:211987036-211987058
|
1:211987051-211987073
|
| Sequence |
CCTGTAACCCCAGCACTTTGAAA |
CTTTGAAAGGGCAAGGTGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 1021, 2: 26569, 3: 321206, 4: 259823} |
{0: 2, 1: 90, 2: 2502, 3: 29774, 4: 86449} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|