ID: 921199629_921199633

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 921199629 921199633
Species Human (GRCh38) Human (GRCh38)
Location 1:212792396-212792418 1:212792425-212792447
Sequence CCGAGGCGGGCGCTGCGCATCTC CCAGGAGATCGTGACCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70} {0: 1, 1: 230, 2: 13448, 3: 168553, 4: 277262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!