ID: 921199631_921199635

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 921199631 921199635
Species Human (GRCh38) Human (GRCh38)
Location 1:212792418-212792440 1:212792434-212792456
Sequence CCTGTGTCCAGGAGATCGTGACC CGTGACCAGCCTGGGCAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 140, 4: 3789} {0: 73, 1: 5566, 2: 69543, 3: 182139, 4: 212878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!