ID: 921207166_921207175

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 921207166 921207175
Species Human (GRCh38) Human (GRCh38)
Location 1:212858594-212858616 1:212858623-212858645
Sequence CCGGTGAATGGGGCCCCCCGGGA CGCTGCCGCCTCGGGAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87} {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!