ID: 921549422_921549424

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 921549422 921549424
Species Human (GRCh38) Human (GRCh38)
Location 1:216515515-216515537 1:216515530-216515552
Sequence CCATTTGTCCTTAAGAACAACAG AACAACAGAATGCTGTCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 221} {0: 1, 1: 0, 2: 2, 3: 13, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!