ID: 921681238_921681244

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 921681238 921681244
Species Human (GRCh38) Human (GRCh38)
Location 1:218034640-218034662 1:218034690-218034712
Sequence CCTCCATTGTGATGATAATGGAT GGTCACCGTAAGCTCCTTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!