ID: 921754978_921754981

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 921754978 921754981
Species Human (GRCh38) Human (GRCh38)
Location 1:218844713-218844735 1:218844753-218844775
Sequence CCCAATATATGCAGCATGTGATT GAATGAAATTATATAATTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 137, 4: 1126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!