ID: 921802403_921802406

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921802403 921802406
Species Human (GRCh38) Human (GRCh38)
Location 1:219416589-219416611 1:219416616-219416638
Sequence CCACTTTTAATTGTATGCAAATT GGTTGATCAATGCAAATTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 34, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!