ID: 922024556_922024559

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 922024556 922024559
Species Human (GRCh38) Human (GRCh38)
Location 1:221738646-221738668 1:221738661-221738683
Sequence CCCCTTTTTAGAAAGATGAGAAA ATGAGAAAACAGTCCCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 586} {0: 1, 1: 9, 2: 63, 3: 250, 4: 914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!