ID: 922031956_922031974

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 922031956 922031974
Species Human (GRCh38) Human (GRCh38)
Location 1:221809969-221809991 1:221810018-221810040
Sequence CCTTCTTAACTTTCTGAGAGCCT CTTCATTCCCAAGGGGAAAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 23, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!