ID: 922031960_922031967

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 922031960 922031967
Species Human (GRCh38) Human (GRCh38)
Location 1:221809989-221810011 1:221810009-221810031
Sequence CCTGGGCCTAAGGCCCATCCAAG AAGGAGGCCCTTCATTCCCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!