ID: 922042582_922042588

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 922042582 922042588
Species Human (GRCh38) Human (GRCh38)
Location 1:221911195-221911217 1:221911240-221911262
Sequence CCACAGACACGGGTCCTAAGGAG TCCACACATAGAATTCCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!