ID: 922101597_922101609

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 922101597 922101609
Species Human (GRCh38) Human (GRCh38)
Location 1:222481843-222481865 1:222481894-222481916
Sequence CCCTACTTCTCCCCTCTGACCAT GACCACCATCATCTCCCGCCTGG
Strand - +
Off-target summary {0: 9, 1: 7, 2: 1, 3: 26, 4: 308} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!