ID: 922101598_922101609

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922101598 922101609
Species Human (GRCh38) Human (GRCh38)
Location 1:222481844-222481866 1:222481894-222481916
Sequence CCTACTTCTCCCCTCTGACCATC GACCACCATCATCTCCCGCCTGG
Strand - +
Off-target summary {0: 9, 1: 8, 2: 4, 3: 44, 4: 362} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!