ID: 922101601_922101604

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 922101601 922101604
Species Human (GRCh38) Human (GRCh38)
Location 1:222481855-222481877 1:222481872-222481894
Sequence CCTCTGACCATCTCTCAACACCA ACACCACCACGACCCTGGTCAGG
Strand - +
Off-target summary {0: 13, 1: 4, 2: 1, 3: 26, 4: 233} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!