ID: 922407326_922407333

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922407326 922407333
Species Human (GRCh38) Human (GRCh38)
Location 1:225328761-225328783 1:225328811-225328833
Sequence CCCCATGCGTTAATATGTAAGTA TTTCTCAAAGGAATCAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84} {0: 1, 1: 0, 2: 4, 3: 62, 4: 654}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!