ID: 922407327_922407332

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 922407327 922407332
Species Human (GRCh38) Human (GRCh38)
Location 1:225328762-225328784 1:225328810-225328832
Sequence CCCATGCGTTAATATGTAAGTAA TTTTCTCAAAGGAATCAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 61, 4: 762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!